Basic organic substances. Classification and nomenclature of organic substances (trivial and international)

Classification of organic substances

Depending on the type of carbon chain structure, organic substances are divided into:

• acyclic and cyclic.
• marginal (saturated) and unsaturated (unsaturated).
• carbocyclic and heterocyclic.
• alicyclic and aromatic.

Acyclic compounds are organic compounds in whose molecules there are no cycles and all carbon atoms are connected to each other in straight or branched open chains.

In turn, among acyclic compounds, saturated (or saturated) ones are distinguished, which contain in the carbon skeleton only single carbon-carbon (C-C) bonds and unsaturated (or unsaturated), containing multiples - double (C=C) or triple (C≡ C) connections.

Cyclic compounds are chemical compounds in which there are three or more bonded atoms forming a ring.

Depending on which atoms form the rings, carbocyclic compounds and heterocyclic compounds are distinguished.

Carbocyclic compounds (or isocyclic) contain only carbon atoms in their rings. These compounds are in turn divided into alicyclic compounds (aliphatic cyclic) and aromatic compounds.

Heterocyclic compounds contain one or more heteroatoms in the hydrocarbon ring, most often oxygen, nitrogen or sulfur atoms.

The simplest class of organic substances are hydrocarbons - compounds that are formed exclusively by carbon and hydrogen atoms, i.e. formally do not have functional groups.

Since hydrocarbons do not have functional groups, they can only be classified according to the type of carbon skeleton. Hydrocarbons, depending on the type of their carbon skeleton, are divided into subclasses:

1) Saturated acyclic hydrocarbons are called alkanes. The general molecular formula of alkanes is written as C n H 2n+2, where n is the number of carbon atoms in the hydrocarbon molecule. These compounds do not have interclass isomers.

2) Acyclic unsaturated hydrocarbons are divided into:

a) alkenes - they contain only one multiple, namely one double C=C bond, the general formula of alkenes is C n H 2n,

b) alkynes – alkyne molecules also contain only one multiple bond, namely a triple C≡C bond. The general molecular formula of alkynes is C n H 2n-2

c) alkadienes – alkadiene molecules contain two double C=C bonds. The general molecular formula of alkadienes is C n H 2n-2

3) Cyclic saturated hydrocarbons are called cycloalkanes and have the general molecular formula C n H 2n.

The remaining organic substances in organic chemistry are considered as derivatives of hydrocarbons, formed by introducing so-called functional groups that contain other chemical elements into hydrocarbon molecules.

Thus, the formula of compounds with one functional group can be written as R-X, where R is a hydrocarbon radical and X is a functional group. A hydrocarbon radical is a fragment of a hydrocarbon molecule without one or more hydrogen atoms.

Based on the presence of certain functional groups, compounds are divided into classes. The main functional groups and the classes of compounds they belong to are presented in the table:

Thus, different combinations of types of carbon skeletons with different functional groups give a wide variety of variants of organic compounds.

Halogenated hydrocarbons

Halogen derivatives of hydrocarbons are compounds obtained by replacing one or more hydrogen atoms in the molecule of a parent hydrocarbon with one or more atoms of a halogen, respectively.

Let some hydrocarbon have the formula C n H m, then when replacing in its molecule X hydrogen atoms per X halogen atoms, the formula of the halogen derivative will be C n H m- X Hal X. Thus, monochlor derivatives of alkanes have the formula C n H 2n+1 Cl, dichloro derivatives CnH2nCl2 etc.

Alcohols and phenols

Alcohols are hydrocarbon derivatives in which one or more hydrogen atoms are replaced by a hydroxyl group -OH. Alcohols with one hydroxyl group are called monatomic, with two - diatomic, with three triatomic etc. For example:

Alcohols with two or more hydroxyl groups are also called polyhydric alcohols. The general formula for saturated monohydric alcohols is C n H 2n+1 OH or C n H 2n+2 O. The general formula for saturated polyhydric alcohols is C n H 2n+2 O x , where x is the atomicity of the alcohol.

Alcohols can also be aromatic. For example:

The general formula of such monohydric aromatic alcohols is C n H 2n-6 O.

However, it should be clearly understood that derivatives of aromatic hydrocarbons in which one or more hydrogen atoms on the aromatic ring are replaced by hydroxyl groups do not apply to alcohols. They belong to the class phenols . For example, this given compound is an alcohol:

And this represents phenol:

The reason why phenols are not classified as alcohols lies in their specific chemical properties, which greatly distinguish them from alcohols. As is easy to see, monohydric phenols are isomeric with monohydric aromatic alcohols, i.e. also have the general molecular formula C n H 2n-6 O.

Amines

Aminami are called ammonia derivatives in which one, two or all three hydrogen atoms are replaced by a hydrocarbon radical.

Amines in which only one hydrogen atom is replaced by a hydrocarbon radical, i.e. having the general formula R-NH 2 are called primary amines.

Amines in which two hydrogen atoms are replaced by hydrocarbon radicals are called secondary amines. The formula for a secondary amine can be written as R-NH-R’. In this case, the radicals R and R’ can be either the same or different. For example:

If amines lack hydrogen atoms at the nitrogen atom, i.e. All three hydrogen atoms of the ammonia molecule are replaced by a hydrocarbon radical, then such amines are called tertiary amines. In general, the formula of a tertiary amine can be written as:

In this case, the radicals R, R’, R’’ can be completely identical, or all three can be different.

The general molecular formula of primary, secondary and tertiary saturated amines is C n H 2 n +3 N.

Aromatic amines with only one unsaturated substituent have the general formula C n H 2 n -5 N

Aldehydes and ketones

Aldehydes are derivatives of hydrocarbons in which two hydrogen atoms are replaced by one oxygen atom at the primary carbon atom, i.e. derivatives of hydrocarbons in the structure of which there is an aldehyde group –CH=O. The general formula of aldehydes can be written as R-CH=O. For example:

Ketones are derivatives of hydrocarbons in which at the secondary carbon atom two hydrogen atoms are replaced by an oxygen atom, i.e. compounds whose structure contains a carbonyl group –C(O)-.

The general formula of ketones can be written as R-C(O)-R’. In this case, the radicals R, R’ can be either the same or different.

For example:

As you can see, aldehydes and ketones are very similar in structure, but they are still distinguished as classes because they have significant differences in chemical properties.

The general molecular formula of saturated ketones and aldehydes is the same and has the form C n H 2 n O

Carboxylic acids

Carboxylic acids are derivatives of hydrocarbons that contain a carboxyl group –COOH.

If an acid has two carboxyl groups, the acid is called dicarboxylic acid.

Saturated monocarboxylic acids (with one -COOH group) have a general molecular formula of the form C n H 2 n O 2

Aromatic monocarboxylic acids have the general formula C n H 2 n -8 O 2

Ethers

Ethers – organic compounds in which two hydrocarbon radicals are indirectly connected through an oxygen atom, i.e. have a formula of the form R-O-R’. In this case, the radicals R and R’ can be either the same or different.

For example:

The general formula of saturated ethers is the same as that of saturated monohydric alcohols, i.e. C n H 2 n +1 OH or C n H 2 n +2 O.

Esters

Esters are a class of compounds based on organic carboxylic acids in which the hydrogen atom in the hydroxyl group is replaced by a hydrocarbon radical R. The formula of esters in general can be written as:

For example:

Nitro compounds

Nitro compounds– derivatives of hydrocarbons in which one or more hydrogen atoms are replaced by a nitro group –NO 2.

Saturated nitro compounds with one nitro group have the general molecular formula C n H 2 n +1 NO 2

Amino acids

Compounds that simultaneously have two functional groups in their structure - amino NH 2 and carboxyl - COOH. For example,

NH 2 -CH 2 -COOH

Sodium amino acids with one carboxyl and one amino group are isomeric to the corresponding saturated nitro compounds, i.e. just like they have the general molecular formula C n H 2 n +1 NO 2

In USE tasks on the classification of organic substances, it is important to be able to write general molecular formulas of homologous series of different types of compounds, knowing the structural features of the carbon skeleton and the presence of certain functional groups. In order to learn how to determine the general molecular formulas of organic compounds of different classes, material on this topic will be useful.

Nomenclature of organic compounds

The structural features and chemical properties of the compounds are reflected in the nomenclature. The main types of nomenclature are considered systematic And trivial.

Systematic nomenclature actually prescribes algorithms, according to which a particular name is compiled in strict accordance with the structural features of the molecule of an organic substance or, roughly speaking, its structural formula.

Let's consider the rules for compiling the names of organic compounds according to systematic nomenclature.

When compiling the names of organic substances according to systematic nomenclature, the most important thing is to correctly determine the number of carbon atoms in the longest carbon chain or count the number of carbon atoms in the cycle.

Depending on the number of carbon atoms in the main carbon chain, compounds will have a different root in their name:

The second important component taken into account when composing names is the presence/absence of multiple bonds or a functional group, which are listed in the table above.

Let's try to give a name to a substance that has a structural formula:

1. The main (and only) carbon chain of this molecule contains 4 carbon atoms, so the name will contain the root but-;

2. There are no multiple bonds in the carbon skeleton, therefore, the suffix that must be used after the root of the word will be -an, as with the corresponding saturated acyclic hydrocarbons (alkanes);

3. The presence of a functional group –OH, provided that there are no higher functional groups, is added after the root and suffix from paragraph 2. another suffix – “ol”;

4. In molecules containing multiple bonds or functional groups, the numbering of the carbon atoms of the main chain begins from the side of the molecule to which they are closest.

Let's look at another example:

The presence of four carbon atoms in the main carbon chain tells us that the basis of the name is the root “but-”, and the absence of multiple bonds indicates the suffix “-an”, which will follow immediately after the root. The senior group in this compound is carboxyl, which determines whether this substance belongs to the class of carboxylic acids. Therefore, the ending of the name will be “-ic acid”. At the second carbon atom there is an amino group NH 2—, therefore this substance belongs to amino acids. Also at the third carbon atom we see the hydrocarbon radical methyl ( CH 3—). Therefore, according to systematic nomenclature, this compound is called 2-amino-3-methylbutanoic acid.

Trivial nomenclature, in contrast to systematic nomenclature, as a rule, has no connection with the structure of a substance, but is determined for the most part by its origin, as well as chemical or physical properties.

From Guest >>

1. What is the name of an organic substance whose molecules contain C, O, H atoms that perform an energy and construction function?
A-nucleic acid B-protein
B-carbohydrate G-ATP
2.What carbohydrates are polymers?
A-monosaccharides B-disaccharides C-polysaccharides
3.The group of monosaccharides includes:
A-glucose B-sucrose C-cellulose
4.Which carbohydrates are insoluble in water?
A-glucose, fructose B-starch C-ribose, deoxyribose
5.Fat molecules are formed:
A-from glycerol, higher carboxylic acids B-from glucose
B-from amino acids, water D-from ethyl alcohol, higher carboxylic acids
6.Fats perform the following functions in the cell:
A-transport B-energy
B-catalytic G-information
7.What compounds do lipids belong to in relation to water?
A-hydrophilic B-hydrophobic
8.What is the importance of fats in animals?
A-membrane structure B-thermoregulation
B-source of energy D-source of water D-all of the above
9. Protein monomers are:
A-nucleotides B-amino acids B-glucose G-fats
10. The most important organic substance that is part of the cells of all kingdoms of living nature, which has a primary linear configuration, is:
A-to polysaccharides B-to lipids
B-to ATP G-to polypeptides
2. Write the functions of proteins, give examples.
3. Task: Based on the DNA chain AATTGCGATGCTTAGTTTAGG, it is necessary to complete the complementary chain and determine the length of the DNA

1. Choose one correct answer
1. How many of the known amino acids are involved in protein synthesis?
A-20 B-100 B-23
2.What part of amino acid molecules distinguishes them from each other?
A-radical B-carboxyl group B-amino group
3. what compounds are included in ATP?
A- adenine, ribose carbohydrate, 3 molecules of phosphoric acid
B- guanine, fructose sugar, phosphoric acid residue.
B-ribose, glycerol and any amino acid
4.What is the role of ATP molecules in the cell?
A-provide transport function B-transmit hereditary information
B-provide vital processes with energy D-accelerate biochemical reactions
5.monomers of nucleic acids are:
A-amino acids B-fats
B-nucleotides G-glucose
6.What class of chemical substances does ribose belong to?
A-protein B-carbohydrate C-lipid
7.Which nucleotide is not included in the DNA molecule?
A-adenylic B-uridylic
B-guanyl G-thymidyl
8.Which nucleic acid has the longest length?
A-DNA B-RNA
9. The nucleotide complementary to a guanyl nucleotide is:
A-thymidyl B-cytidyl
B-adenyl G-uridyl
10.The process of doubling DNA molecules is called:
A-replication B-transcription
B-complementarity with G-translation.
2. Write the functions of lipids, give examples.
3. Task. In what sequence will the nucleotides be located in the i-RNA, if the DNA chain has the following composition: GGTATAGCGCTTAAGCCTT, determine the length of the i-RNA.

From Guest >>

1. What is the name of an organic substance whose molecules contain C, O, H atoms that perform an energy and construction function?
A-nucleic acid B-protein
B-carbohydrate G-ATP
2.What carbohydrates are polymers?
A-monosaccharides B-disaccharides C-polysaccharides
3.The group of monosaccharides includes:
A-glucose B-sucrose C-cellulose
4.Which carbohydrates are insoluble in water?
A-glucose, fructose B-starch C-ribose, deoxyribose
5.Fat molecules are formed:
A-from glycerol, higher carboxylic acids B-from glucose
B-from amino acids, water D-from ethyl alcohol, higher carboxylic acids
6.Fats perform the following functions in the cell:
A-transport B-energy
B-catalytic G-information
7.What compounds do lipids belong to in relation to water?
A-hydrophilic B-hydrophobic
8.What is the importance of fats in animals?
A-membrane structure B-thermoregulation
B-source of energy D-source of water D-all of the above
9. Protein monomers are:
A-nucleotides B-amino acids B-glucose G-fats
10. The most important organic substance that is part of the cells of all kingdoms of living nature, which has a primary linear configuration, is:
A-to polysaccharides B-to lipids
B-to ATP G-to polypeptides
2. Write the functions of proteins, give examples.
3. Task: Based on the DNA chain AATTGCGATGCTTAGTTTAGG, it is necessary to complete the complementary chain and determine the length of the DNA
1. Choose one correct answer
1. How many of the known amino acids are involved in protein synthesis?
A-20 B-100 B-23
2.What part of amino acid molecules distinguishes them from each other?
A-radical B-carboxyl group B-amino group
3. what compounds are included in ATP?
A- adenine, ribose carbohydrate, 3 molecules of phosphoric acid
B- guanine, fructose sugar, phosphoric acid residue.
B-ribose, glycerol and any amino acid
4.What is the role of ATP molecules in the cell?
A-provide transport function B-transmit hereditary information
B-provide vital processes with energy D-accelerate biochemical reactions
5.monomers of nucleic acids are:
A-amino acids B-fats
B-nucleotides G-glucose
6.What class of chemical substances does ribose belong to?
A-protein B-carbohydrate C-lipid
7.Which nucleotide is not included in the DNA molecule?
A-adenylic B-uridylic
B-guanyl G-thymidyl
8.Which nucleic acid has the longest length?
A-DNA B-RNA
9. The nucleotide complementary to a guanyl nucleotide is:
A-thymidyl B-cytidyl
B-adenyl G-uridyl
10.The process of doubling DNA molecules is called:
A-replication B-transcription
B-complementarity with G-translation.
2. Write the functions of lipids, give examples.
3. Task. In what sequence will the nucleotides be located in the i-RNA, if the DNA chain has the following composition: GGTATAGCGCTTAAGCCTT, determine the length of the i-RNA.

Organic matter is a chemical compound that contains carbon. The only exceptions are carbonic acid, carbides, carbonates, cyanides and carbon oxides.

Story

The term “organic substances” itself appeared in the everyday life of scientists at the stage of early development of chemistry. At that time, vitalistic worldviews dominated. This was a continuation of the traditions of Aristotle and Pliny. During this period, pundits were busy dividing the world into living and nonliving. Moreover, all substances without exception were clearly divided into mineral and organic. It was believed that a special “force” was needed to synthesize compounds of “living” substances. It is inherent in all living beings, and without it organic elements cannot be formed.

This statement, ridiculous for modern science, prevailed for a very long time, until in 1828 Friedrich Wöhler experimentally refuted it. He was able to obtain organic urea from inorganic ammonium cyanate. This pushed chemistry forward. However, the division of substances into organic and inorganic has been preserved in the present tense. It forms the basis of classification. Almost 27 million organic compounds are known.

Why are there so many organic compounds?

Organic matter is, with some exceptions, a carbon compound. This is actually a very interesting element. Carbon is capable of forming chains from its atoms. It is very important that the connection between them is stable.

In addition, carbon in organic substances exhibits valence - IV. It follows from this that this element is capable of forming not only single, but also double and triple bonds with other substances. As their multiplicity increases, the chain consisting of atoms will become shorter. At the same time, the stability of the connection only increases.

Carbon also has the ability to form flat, linear and three-dimensional structures. This is why there are so many different organic substances in nature.

Compound

As mentioned above, organic matter is carbon compounds. And this is very important. arise when it is associated with almost any element of the periodic table. In nature, most often their composition (in addition to carbon) includes oxygen, hydrogen, sulfur, nitrogen and phosphorus. The remaining elements are much less common.

Properties

So, organic matter is a carbon compound. However, there are several important criteria that it must meet. All substances of organic origin have common properties:

1. The different typology of bonds existing between atoms certainly leads to the appearance of isomers. First of all, they are formed when carbon molecules combine. Isomers are different substances that have the same molecular weight and composition, but different chemical and physical properties. This phenomenon is called isomerism.

2. Another criterion is the phenomenon of homology. These are series of organic compounds, in which the formula of neighboring substances differs from the previous ones by one CH 2 group. This important property is used in materials science.

What classes of organic substances are there?

Organic compounds include several classes. Everyone knows them. lipids and carbohydrates. These groups can be called biological polymers. They are involved in metabolism at the cellular level in any organism. Also included in this group are nucleic acids. So we can say that organic matter is what we eat every day, what we are made of.

Squirrels

Proteins consist of structural components - amino acids. These are their monomers. Proteins are also called proteins. About 200 types of amino acids are known. All of them are found in living organisms. But only twenty of them are components of proteins. They are called basic. But in the literature you can also find less popular terms - proteinogenic and protein-forming amino acids. The formula of an organic substance of this class contains amine (-NH 2) and carboxyl (-COOH) components. They are connected to each other by the same carbon bonds.

Functions of proteins

Proteins perform many important functions in the body of plants and animals. But the main one is structural. Proteins are the main components of the cell membrane and the matrix of organelles in cells. In our body, all the walls of arteries, veins and capillaries, tendons and cartilage, nails and hair consist mainly of different proteins.

The next function is enzymatic. Proteins act as enzymes. They catalyze chemical reactions in the body. They are responsible for the breakdown of nutritional components in the digestive tract. In plants, enzymes fix the position of carbon during photosynthesis.

Some transport various substances in the body, such as oxygen. Organic matter is also capable of attaching to them. This is how the transport function is carried out. Proteins carry metal ions, fatty acids, hormones and, of course, carbon dioxide and hemoglobin through blood vessels. Transport also occurs at the intercellular level.

Protein compounds - immunoglobulins - are responsible for performing a protective function. These are blood antibodies. For example, thrombin and fibrinogen are actively involved in the coagulation process. Thus, they prevent large blood loss.

Proteins are also responsible for performing the contractile function. Due to the fact that myosin and actin protofibrils constantly perform sliding movements relative to each other, muscle fibers contract. But similar processes also occur in single-celled organisms. The movement of bacterial flagella is also directly related to the sliding of microtubules, which are protein in nature.

The oxidation of organic substances releases large amounts of energy. But, as a rule, proteins are spent on energy needs very rarely. This happens when all reserves are exhausted. Lipids and carbohydrates are best suited for this. Therefore, proteins can perform an energy function, but only under certain conditions.

Lipids

An organic substance is also a fat-like compound. Lipids belong to the simplest biological molecules. They are insoluble in water, but disintegrate in non-polar solutions such as gasoline, ether and chloroform. They are part of all living cells. Chemically, lipids are alcohols and carboxylic acids. The most famous of them are fats. In the body of animals and plants, these substances perform many important functions. Many lipids are used in medicine and industry.

Functions of lipids

These organic chemicals, together with proteins in cells, form biological membranes. But their main function is energy. When fat molecules are oxidized, a huge amount of energy is released. It goes to the formation of ATP in cells. Significant amounts of energy reserves can be stored in the body in the form of lipids. Sometimes there are even more of them than are needed for normal life activities. With pathological changes in metabolism, there are more “fat” cells. Although in fairness it should be noted that such excessive reserves are simply necessary for hibernating animals and plants. Many people believe that trees and shrubs feed on soil during the cold season. In reality, they use up the reserves of oils and fats that they made over the summer.

In the human and animal body, fats can also perform a protective function. They are deposited in the subcutaneous tissue and around organs such as the kidneys and intestines. Thus, they serve as good protection against mechanical damage, that is, impacts.

In addition, fats have a low level of thermal conductivity, which helps retain heat. This is very important, especially in cold climates. In marine animals, the subcutaneous fat layer also contributes to good buoyancy. But in birds, lipids also perform water-repellent and lubricating functions. The wax coats their feathers and makes them more flexible. Some types of plants have the same coating on the leaves.

Carbohydrates

The formula of an organic substance C n (H 2 O) m indicates that the compound belongs to the class of carbohydrates. The name of these molecules refers to the fact that they contain oxygen and hydrogen in the same amount as water. In addition to these chemical elements, compounds may contain, for example, nitrogen.

Carbohydrates in the cell are the main group of organic compounds. These are primary products. They are also the initial products of the synthesis in plants of other substances, for example, alcohols, organic acids and amino acids. Carbohydrates are also found in animal and fungal cells. They are also found among the main components of bacteria and protozoa. So, in an animal cell there are from 1 to 2% of them, and in a plant cell their amount can reach 90%.

Today there are only three groups of carbohydrates:

Simple sugars (monosaccharides);

Oligosaccharides, consisting of several molecules of simple sugars connected in series;

Polysaccharides, they contain more than 10 molecules of monosaccharides and their derivatives.

Functions of carbohydrates

All organic substances in a cell perform certain functions. For example, glucose is the main energy source. It is broken down in cells all occurring during cellular respiration. Glycogen and starch constitute the main energy reserves, the former in animals and the latter in plants.

Carbohydrates also perform a structural function. Cellulose is the main component of plant cell walls. And in arthropods, chitin performs the same function. It is also found in the cells of higher fungi. If we take oligosaccharides as an example, they are part of the cytoplasmic membrane - in the form of glycolipids and glycoproteins. Glycocalyx is also often detected in cells. Pentoses are involved in the synthesis of nucleic acids. When is included in DNA, and ribose is included in RNA. These components are also found in coenzymes, for example, FAD, NADP and NAD.

Carbohydrates are also capable of performing a protective function in the body. In animals, the substance heparin actively prevents rapid blood clotting. It is formed during tissue damage and blocks the formation of blood clots in blood vessels. Heparin is found in large quantities in mast cells in granules.

Nucleic acids

Proteins, carbohydrates and lipids are not all known classes of organic substances. Chemistry also includes nucleic acids. These are phosphorus-containing biopolymers. They, located in the cell nucleus and cytoplasm of all living beings, ensure the transmission and storage of genetic data. These substances were discovered thanks to the biochemist F. Miescher, who studied salmon sperm. This was an "accidental" discovery. A little later, RNA and DNA were discovered in all plant and animal organisms. Nucleic acids were also isolated in the cells of fungi and bacteria, as well as viruses.

In total, two types of nucleic acids have been found in nature - ribonucleic acids (RNA) and deoxyribonucleic acids (DNA). The difference is clear from the name. deoxyribose is a five-carbon sugar. And ribose is found in the RNA molecule.

Organic chemistry deals with the study of nucleic acids. Topics for research are also dictated by medicine. DNA codes hide many genetic diseases that scientists have yet to discover.

It is known that the properties of organic substances are determined by their composition and chemical structure. Therefore, it is not surprising that the classification of organic compounds is based on the theory of structure - the theory of L. M. Butlerov. Organic substances are classified according to the presence and order of connection of atoms in their molecules. The most durable and least changeable part of an organic substance molecule is its skeleton - a chain of carbon atoms. Depending on the order of connection of carbon atoms in this chain, substances are divided into acyclic, which do not contain closed chains of carbon atoms in molecules, and carbocyclic, which contain such chains (cycles) in molecules.
In addition to carbon and hydrogen atoms, molecules of organic substances can contain atoms of other chemical elements. Substances in whose molecules these so-called heteroatoms are included in a closed chain are classified as heterocyclic compounds.
Heteroatoms (oxygen, nitrogen, etc.) can be part of molecules and acyclic compounds, forming functional groups in them, for example, hydroxyl - OH, carbonyl, carboxyl, amino group -NH2.
Functional group- a group of atoms that determines the most characteristic chemical properties of a substance and its belonging to a certain class of compounds.

Hydrocarbons- These are compounds consisting only of hydrogen and carbon atoms.

Depending on the structure of the carbon chain, organic compounds are divided into open-chain compounds - acyclic (aliphatic) and cyclic- with a closed chain of atoms.

Cyclic ones are divided into two groups: carbocyclic compounds(cycles are formed only by carbon atoms) and heterocyclic(the cycles also include other atoms, such as oxygen, nitrogen, sulfur).

Carbocyclic compounds, in turn, include two series of compounds: alicyclic and aromatic.

Aromatic compounds, based on the structure of their molecules, have flat carbon-containing rings with a special closed system of p-electrons, forming a common π-system (a single π-electron cloud). Aromaticity is also characteristic of many heterocyclic compounds.

All other carbocyclic compounds belong to the alicyclic series.

Both acyclic (aliphatic) and cyclic hydrocarbons can contain multiple (double or triple) bonds. Such hydrocarbons are called unsaturated (unsaturated) in contrast to saturated (saturated), containing only single bonds.

Saturated aliphatic hydrocarbons called alkanes, they have the general formula C n H 2 n +2, where n is the number of carbon atoms. Their old name is often used today - paraffins.

Containing one double bond, got the name alkenes. They have the general formula C n H 2 n.

Unsaturated aliphatic hydrocarbonswith two double bonds called alkadienes

Unsaturated aliphatic hydrocarbonswith one triple bond called alkynes. Their general formula is C n H 2 n - 2.

Saturated alicyclic hydrocarbons - cycloalkanes, their general formula is C n H 2 n.

A special group of hydrocarbons aromatic, or arenas(with a closed common π-electron system), known from the example of hydrocarbons with the general formula C n H 2 n -6.

Thus, if in their molecules one or more hydrogen atoms are replaced by other atoms or groups of atoms (halogens, hydroxyl groups, amino groups, etc.), hydrocarbon derivatives: halogen derivatives, oxygen-containing, nitrogen-containing and other organic compounds.

Halogen derivatives hydrocarbons can be considered as products of the replacement of one or more hydrogen atoms in hydrocarbons by halogen atoms. In accordance with this, saturated and unsaturated mono-, di-, tri- (in the general case poly-) halogen derivatives can exist.

General formula of monohalogen derivatives of saturated hydrocarbons:

and the composition is expressed by the formula

C n H 2 n +1 G,

where R is the remainder of a saturated hydrocarbon (alkane), a hydrocarbon radical (this designation is used further when considering other classes of organic substances), G is a halogen atom (F, Cl, Br, I).

Alcohols- derivatives of hydrocarbons in which one or more hydrogen atoms are replaced by hydroxyl groups.

Alcohols are called monatomic, if they have one hydroxyl group, and limiting if they are derivatives of alkanes.

General formula of saturated monohydric alcohols:

and their composition is expressed by the general formula:
C n H 2 n +1 OH or C n H 2 n +2 O

There are known examples of polyhydric alcohols, i.e., those having several hydroxyl groups.

Phenols- derivatives of aromatic hydrocarbons (benzene series), in which one or more hydrogen atoms in the benzene ring are replaced by hydroxyl groups.

The simplest representative with the formula C 6 H 5 OH is called phenol.

Aldehydes and ketones- derivatives of hydrocarbons containing a carbonyl group of atoms (carbonyl).

In aldehyde molecules, one carbonyl bond connects with a hydrogen atom, the other with a hydrocarbon radical.

In the case of ketones, the carbonyl group is bonded to two (generally different) radicals.

The composition of saturated aldehydes and ketones is expressed by the formula C n H 2l O.

Carboxylic acids- hydrocarbon derivatives containing carboxyl groups (-COOH).

If there is one carboxyl group in an acid molecule, then the carboxylic acid is monobasic. General formula of saturated monobasic acids (R-COOH). Their composition is expressed by the formula C n H 2 n O 2.

Ethers are organic substances containing two hydrocarbon radicals connected by an oxygen atom: R-O-R or R 1 -O-R 2.

Radicals can be the same or different. The composition of ethers is expressed by the formula C n H 2 n +2 O

Esters- compounds formed by replacing the hydrogen atom of the carboxyl group in carboxylic acids with a hydrocarbon radical.

Nitro compounds- derivatives of hydrocarbons in which one or more hydrogen atoms are replaced by a nitro group -NO 2.

General formula of saturated mononitro compounds:

and the composition is expressed by the general formula

C n H 2 n +1 NO 2 .

Amines- compounds that are considered as derivatives of ammonia (NH 3), in which hydrogen atoms are replaced by hydrocarbon radicals.

Depending on the nature of the radical, amines can be aliphaticand aromatic.

Depending on the number of hydrogen atoms replaced by radicals, the following are distinguished:

Primary amines with the general formula: R-NNH 2

Secondary - with the general formula: R 1 -NН-R 2

Tertiary - with the general formula:

In a particular case, secondary and tertiary amines may have the same radicals.

Primary amines can also be considered as derivatives of hydrocarbons (alkanes), in which one hydrogen atom is replaced by an amino group -NH 2. The composition of saturated primary amines is expressed by the formula C n H 2 n +3 N.

Amino acids contain two functional groups connected to a hydrocarbon radical: an amino group -NH 2, and a carboxyl -COOH.

The composition of saturated amino acids containing one amino group and one carboxyl is expressed by the formula C n H 2 n +1 NO 2.

Other important organic compounds are known that have several different or identical functional groups, long linear chains connected to benzene rings. In such cases, a strict determination of whether a substance belongs to a specific class is impossible. These compounds are often classified into specific groups of substances: carbohydrates, proteins, nucleic acids, antibiotics, alkaloids, etc.

To name organic compounds, two nomenclatures are used: rational and systematic (IUPAC) and trivial names.

Compilation of names according to IUPAC nomenclature

1) The name of the compound is based on the root of the word, denoting a saturated hydrocarbon with the same number of atoms as the main chain.

2) A suffix is ​​added to the root, characterizing the degree of saturation:

An (ultimate, no multiple connections);
-ene (in the presence of a double bond);
-in (in the presence of a triple bond).

If there are several multiple bonds, then the suffix indicates the number of such bonds (-diene, -triene, etc.), and after the suffix the position of the multiple bond must be indicated in numbers, for example:
CH 3 –CH 2 –CH=CH 2 CH 3 –CH=CH–CH 3
butene-1 butene-2

CH 2 =CH–CH=CH2
butadiene-1,3

Groups such as nitro-, halogens, hydrocarbon radicals that are not included in the main chain are placed in the prefix. They are listed in alphabetical order. The position of the substituent is indicated by the number before the prefix.

The order of naming is as follows:

1. Find the longest chain of C atoms.

2. Number the carbon atoms of the main chain sequentially, starting from the end closest to the branch.

3. The name of the alkane is composed of the names of the side radicals, listed in alphabetical order, indicating the position in the main chain, and the name of the main chain.

Nomenclature of some organic substances (trivial and international)